Sequence ID | >WENV170016300 |
Genome ID | AZIJ01022391 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 1382 |
End posion on genome | 1458 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
atcagcaatt |
tRNA gene sequence |
GGGGGATTAGCTCAGCTGGCTAGAGCGCTTGCCTGGCAGGCAAGAGGTCACCGGTTCGAC |
Downstream region at tRNA end position |
aaaaaccacc |
Secondary structure (Cloverleaf model) | >WENV170016300 Ala GGC t ACAA aaaaaccacc G - C G - C G + T G - C G + T A - T T - A T C T T G G C C A C G A A | | | | | G T C T C G A C C G G C G | | | | T T G G A G C C T A G AGGTC C - G T - A T - A G - C C - G C G T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |