Sequence ID | >WENV170016302 |
Genome ID | AZIJ01022740 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 1866 |
End posion on genome | 1791 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
gatacggtga |
tRNA gene sequence |
GAGCCGGTAGCTCAGCTGGTAGAGCATTCGACTTTTAATCGAATGGTCGTGGGTTCGAGT |
Downstream region at tRNA end position |
tttcccctgc |
Secondary structure (Cloverleaf model) | >WENV170016302 Lys TTT a ACCA tttcccctgc G - C A - T G - C C - G C - G G - C G - C T G T C A C C C A C G A A | | | | | G T C T C G G T G G G C G | | | | T T G G A G C T A A TGGTC T - A T - A C - G G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |