Sequence ID | >WENV170016304 |
Genome ID | AZIJ01022922 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 3298 |
End posion on genome | 3223 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
ggctgtcttt |
tRNA gene sequence |
AGGAGTGTAGCTCAACTGGTAGAGCACCGGTCTCCAAAACCGGGGGTTGGGGGTTCGAGC |
Downstream region at tRNA end position |
ccgccagaag |
Secondary structure (Cloverleaf model) | >WENV170016304 Trp CCA t GCCA ccgccagaag A - T G - C G - C A - T G - C T - A G - C C G T C T C C C A C A A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C T A A GGGTT C - G C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |