Sequence ID | >WENV170016305 |
Genome ID | AZIJ01022950 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 1769 |
End posion on genome | 1693 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
cttgttccgt |
tRNA gene sequence |
GCAGCCATAGCTCAGCTGGTTAGAGCGCTAGATTGTGGATCTAGAGGTCCCCCGTTCGAA |
Downstream region at tRNA end position |
ccttttctct |
Secondary structure (Cloverleaf model) | >WENV170016305 His GTG t ACCA ccttttctct G + T C - G A - T G - C C - G C - G A - T C A T G G G G C A C G A A | | | | | G T C T C G C C C C G C G | | | | T T G G A G C T T A G AGGTC C - G T - A A - T G - C A - T T A T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |