Sequence ID | >WENV170016307 |
Genome ID | AZIJ01022973 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 1553 |
End posion on genome | 1477 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
gccccgttaa |
tRNA gene sequence |
CGGCATGTAGCGCAGCCTGGTAGCGCACTTCGTTCGGGACGAAGGGGTCGGAGGTTCGAA |
Downstream region at tRNA end position |
gattcataaa |
Secondary structure (Cloverleaf model) | >WENV170016307 Pro CGG a ACCA gattcataaa C - G G - C G - C C - G A - T T - A G - C T A T T C T C C A C G A A + | | | | G C C G C G G G A G G C T | | | | T T G G C G C G T A A GGGTC C - G T - A T - A C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |