Sequence ID | >WENV170016308 |
Genome ID | AZIJ01023006 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 1133 |
End posion on genome | 1206 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
acctctcttt |
tRNA gene sequence |
GGCGCGTTAGCAAAGTGGTTATGCAGCGGATTGCAAATCCGTTTAGTCCGGTTCGATTCC |
Downstream region at tRNA end position |
tctctcttat |
Secondary structure (Cloverleaf model) | >WENV170016308 Cys GCA t TCCA tctctcttat G - C G - C C - G G - C C - G G - C T - A T T T A G G C C A G A A | | | | | G T A A C G T C C G G C G | | | T T G A T G C T T A TTAG G + T C - G G - C G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |