Sequence ID | >WENV170016309 |
Genome ID | AZIJ01023006 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 1230 |
End posion on genome | 1316 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
aaacgtctac |
tRNA gene sequence |
GCCCGGATGGTGAAATCGGTAGACACAAGGGATTTAAAATCCCTCGCTCGCAAGGGCGTG |
Downstream region at tRNA end position |
tgtaaatcaa |
Secondary structure (Cloverleaf model) | >WENV170016309 Leu TAA c ACCA tgtaaatcaa G - C C - G C - G C - G G - C G - C A - T T G T C G C C C A T A A G | | | | | A C A G T G G C G G G C G | | | T T G A C A C T A G A CGCTCGCAAGGGCGT A - T G - C G - C G - C A - T T A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |