Sequence ID | >WENV170016310 |
Genome ID | AZIJ01023070 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 876 |
End posion on genome | 950 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
gaactggttt |
tRNA gene sequence |
GTCCCCTTCGTCTAGCGGTCAGGACATCGCCCTCTCACGGCGAAAACAGGGGTTCGATTC |
Downstream region at tRNA end position |
attcctccaa |
Secondary structure (Cloverleaf model) | >WENV170016310 Glu CTC t ACCA attcctccaa G + T T - A C - G C - G C - G C - G T - A T T T T C C C C A C G A C | | | | | G G T C T G A G G G G C G + | | | T T T G G A C C A A AAAC T - A C - G G - C C - G C - G C C T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |