Sequence ID | >WENV170016311 |
Genome ID | AZIJ01023112 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 7406 |
End posion on genome | 7492 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
agtccccagt |
tRNA gene sequence |
GCCTGGGTGGCGAAATTGGTAGACGCAGCGGATTCAAAATCCGCCGGGATAAAACCCGTG |
Downstream region at tRNA end position |
cttccaaaaa |
Secondary structure (Cloverleaf model) | >WENV170016311 Leu CAA t ACCA cttccaaaaa G - C C - G C - G T - A G + T G - C G - C T G T C A G C C A T A A G | | | | | G T A G C G G T C G G C G | | | T T G A C G C T A G A CGGGATAAAACCCGT G - C C - G G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |