Sequence ID | >WENV170016316 |
Genome ID | AZIJ01023167 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 7234 |
End posion on genome | 7307 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
ggcggcgttt |
tRNA gene sequence |
TGGGGGATCGTCTAATGGTAGGACAGCGGACTCTGACTCCGCCAGTCTAGGTTCGAATCC |
Downstream region at tRNA end position |
attccagtta |
Secondary structure (Cloverleaf model) | >WENV170016316 Gln CTG t GCCA attccagtta T - A G - C G - C G - C G - C G - C A - T T A T G A T C C A A A C | | | | | G T T C T G C T A G G C G + | | | T T G G G A C T A A CAGT G - C C - G G - C G - C A - T C C T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |