Sequence ID | >WENV170016319 |
Genome ID | AZIJ01023204 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 10795 |
End posion on genome | 10719 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
cggtttccgg |
tRNA gene sequence |
GGCGGAGTAGCTCAGTTGGTTAGAGCAGCGGAATCATAATCCGTGTGTCCCCAGTTCGAA |
Downstream region at tRNA end position |
atcaaatcaa |
Secondary structure (Cloverleaf model) | >WENV170016319 Met CAT g ACCA atcaaatcaa G + T G - C C - G G - C G - C A - T G - C T A T G G G T C A T G A A | | | | | G T C T C G C C C A G C G | | | | T T G G A G C T T A A GTGTC G + T C - G G - C G - C A - T A A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |