Sequence ID | >WENV170016320 |
Genome ID | AZIJ01023214 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 16441 |
End posion on genome | 16526 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
acgcttcagt |
tRNA gene sequence |
GCCCCTGTGGCGGAATGGTAGACGCGGCAGACTCAAAATCTGTTGTTGGCAACAACGTGC |
Downstream region at tRNA end position |
gttttcagcc |
Secondary structure (Cloverleaf model) | >WENV170016320 Leu CAA t ACCA gttttcagcc G - C C - G C - G C - G C - G T - A G - C T G T C G G C C A T A A G | | + | | G G G G C G G C T G G C G | | | T T T A C G C A G G TGTTGGCAACAACGT G + T C - G A - T G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |