| Sequence ID | >WENV170016322 |
| Genome ID | AZIJ01023219 |
| Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
| Species | |
| Start position on genome | 30355 |
| End posion on genome | 30282 |
| Amino Acid | Cys |
| Anticodon | GCA |
| Upstream region at tRNA start position |
agggaagatt |
| tRNA gene sequence |
GGCCACGTGGCGGAGTGGTGACGCAGCGGACTGCAAATCCGTATACCCCGGTTCGATTCC |
| Downstream region at tRNA end position |
atcacctcat |
| Secondary structure (Cloverleaf model) | >WENV170016322 Cys GCA
t TCCA atcacctcat
G - C
G - C
C - G
C - G
A - T
C - G
G - C T T
T G G G C C A
G A G | | | | | G
T G G C G C C C G G C
G | | | T T
G A C G C
T G A ATAC
G + T
C - G
G - C
G - C
A - T
C A
T A
G C A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |