Sequence ID | >WENV170016322 |
Genome ID | AZIJ01023219 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 30355 |
End posion on genome | 30282 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
agggaagatt |
tRNA gene sequence |
GGCCACGTGGCGGAGTGGTGACGCAGCGGACTGCAAATCCGTATACCCCGGTTCGATTCC |
Downstream region at tRNA end position |
atcacctcat |
Secondary structure (Cloverleaf model) | >WENV170016322 Cys GCA t TCCA atcacctcat G - C G - C C - G C - G A - T C - G G - C T T T G G G C C A G A G | | | | | G T G G C G C C C G G C G | | | T T G A C G C T G A ATAC G + T C - G G - C G - C A - T C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |