Sequence ID | >WENV170016323 |
Genome ID | AZIJ01023219 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 18152 |
End posion on genome | 18078 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
gaccgcttat |
tRNA gene sequence |
TCCTCGGTAGCTCAGTGGTAGAGCAATCGGCTGTTAACCGATCGGTCGCTGGTTCGAATC |
Downstream region at tRNA end position |
gtttcgccgc |
Secondary structure (Cloverleaf model) | >WENV170016323 Asn GTT t GCCA gtttcgccgc T - A C - G C - G T + G C - G G - C G - C T A T C G G C C A G A A | | + | | G T C T C G G C T G G C G | | | | T T G G A G C T A A CGGTC A - T T - A C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |