Sequence ID | >WENV170016328 |
Genome ID | AZIK01000175 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 909 |
End posion on genome | 985 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
ttaaggaaac |
tRNA gene sequence |
GGACGCGTAGCATAACTGGATAGTGCACCTCGTTACGGCCGAGGAGGTTGGGGGTTCGAC |
Downstream region at tRNA end position |
aaaaactcat |
Secondary structure (Cloverleaf model) | >WENV170016328 Arg ACG c ACAA aaaaactcat G - C G + T A - T C - G G + T C - G G - C T C T C T C C C A C A A A | + | | | G T T A C G G G G G G C G + | | | T T G G T G C A T A A AGGTT C - G C - G T - A C - G G - C T C T G A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |