Sequence ID | >WENV170016329 |
Genome ID | AZIK01000202 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 11548 |
End posion on genome | 11638 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
gccgtgaact |
tRNA gene sequence |
GGAGAGATGGCCGAGTGGCTGAAGGCGCACCCCTGCTAAGGGTGTATAGGTTTATACCCT |
Downstream region at tRNA end position |
ctttttctgc |
Secondary structure (Cloverleaf model) | >WENV170016329 Ser GCT t GCCA ctttttctgc G - C G - C A - T G - C A - T G - C A - T T A T C T C C C A T G A G | | | | | G G G C C G G A G G G C G | | | T T C A G G C T G A G TATAGGTTTATACCCTATC C - G A - T C - G C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |