Sequence ID | >WENV170016343 |
Genome ID | AZIK01000766 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 8043 |
End posion on genome | 8119 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
aggtaattgt |
tRNA gene sequence |
CGGGGCGTAGCGCAGCCTGGTAGCGCACTTGTCTGGGGGACAAGGGGTCGCAGGTTCAAA |
Downstream region at tRNA end position |
atttcttatc |
Secondary structure (Cloverleaf model) | >WENV170016343 Pro GGG t ACCA atttcttatc C - G G - C G - C G - C G + T C - G G - C T A T T G T C C A C G A A + | | | | A C C G C G G C A G G C T | | | | T T G G C G C G T A A GGGTC C - G T - A T - A G - C T - A C G T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |