Sequence ID | >WENV170016344 |
Genome ID | AZIK01000769 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 110 |
End posion on genome | 185 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
ttaacgcgat |
tRNA gene sequence |
GTCCCCATCGTCTAGAGGCCTAGGACACCGCCCTTTCACGGCGGTAACAGGGGTTCGAAT |
Downstream region at tRNA end position |
atatcatcaa |
Secondary structure (Cloverleaf model) | >WENV170016344 Glu TTC t ACCA atatcatcaa G + T T - A C - G C - G C - G C - G A - T T A T T C C C C A A G A C | | | | | G G T C T G A G G G G C G + | | | T T C G G A C C T A A TAAC C - G C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |