Sequence ID | >WENV170016348 |
Genome ID | AZIK01000769 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 253937 |
End posion on genome | 253862 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
ctcacgttta |
tRNA gene sequence |
GCGGGAATAGCTCAGTTGGTAGAGCACAACCTTGCCAAGGTTGGGGTCGGGAGTTCGAAT |
Downstream region at tRNA end position |
agtattttaa |
Secondary structure (Cloverleaf model) | >WENV170016348 Gly GCC a TCCA agtattttaa G - C C - G G - C G - C G - C A - T A - T T A T T C C T C A T G A A + | | | | G T C T C G G G G A G C G | | | | T T G G A G C T A A GGGTC C - G A - T A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |