Sequence ID | >WENV170016349 |
Genome ID | AZIK01000769 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 253814 |
End posion on genome | 253741 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
ttgctaaaac |
tRNA gene sequence |
GGCGCGATAGCAAAATGGTTATGCTGCGGATTGCAAATCCGCCGATGCCGGTTCGATTCC |
Downstream region at tRNA end position |
ttgttaaaag |
Secondary structure (Cloverleaf model) | >WENV170016349 Cys GCA c TCCA ttgttaaaag G - C G - C C - G G - C C - G G - C A - T T T T C G G C C A A A A | | | | | G T A A C G G C C G G C G | | | T T G A T G C T T T CGAT G - C C - G G - C G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |