Sequence ID | >WENV170016350 |
Genome ID | AZIK01000769 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 253658 |
End posion on genome | 253572 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
tacacccaat |
tRNA gene sequence |
GCCCGGGTGGTGAAATTGGTAGACACACAAGACTTAAAATCTTGCGACTTAACGGTCGTG |
Downstream region at tRNA end position |
ttttattttt |
Secondary structure (Cloverleaf model) | >WENV170016350 Leu TAA t ACCA ttttattttt G - C C - G C - G C - G G - C G - C G + T T T T C G G C C A T A A G | | | | | G T A G T G G C C G G C G | | | T T G A C A C T A G A CGACTTAACGGTCGT C - G A - T A - T G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |