Sequence ID | >WENV170016357 |
Genome ID | AZIK01001046 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 2071 |
End posion on genome | 2146 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
cagccgttga |
tRNA gene sequence |
GGGGCCATAGCTCAGCTGGGAGAGCGCAACACTGGCAGTGTTGAGGTCGGCGGTTCGATC |
Downstream region at tRNA end position |
atttctagtc |
Secondary structure (Cloverleaf model) | >WENV170016357 Ala GGC a ACCA atttctagtc G - C G - C G + T G - C C - G C - G A - T C T T C C G C C A C G A A | | | | | G T C T C G G G C G G C G | | | | T T G G A G C G A G AGGTC C - G A - T A - T C - G A - T C G T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |