Sequence ID | >WENV170016362 |
Genome ID | AZIK01001216 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 2981 |
End posion on genome | 3056 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
gcttgaaagt |
tRNA gene sequence |
GGGTGGTTAGCTCAGCTGGGAGAGCATCGCCCTTACAAGGCGAGGGTCACTGGTTCGATC |
Downstream region at tRNA end position |
ctttcaaatg |
Secondary structure (Cloverleaf model) | >WENV170016362 Val TAC t ACCA ctttcaaatg G - C G - C G - C T - A G - C G - C T - A C T T T G A C C A C G A A | | | | | G T C T C G A C T G G C G | | | | T T G G A G C G A A GGGTC T - A C - G G - C C - G C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |