Sequence ID | >WENV170016370 |
Genome ID | AZIK01001891 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 105 |
End posion on genome | 181 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
aaaggcgatt |
tRNA gene sequence |
GGGTCTGTAGCTCAGTTGGTTAGAGCGCACCCCTGATAAGGGTGAGGTCGGCAGTTCGAA |
Downstream region at tRNA end position |
attgtcgagg |
Secondary structure (Cloverleaf model) | >WENV170016370 Ile GAT t ACCA attgtcgagg G - C G - C G - C T - A C - G T - A G - C T A T C C G T C A T G A A | | | | | G T C T C G G G C A G C G | | | | T T G G A G C T T A G AGGTC C - G A - T C - G C - G C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |