Sequence ID | >WENV170016372 |
Genome ID | AZIK01001905 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 49640 |
End posion on genome | 49553 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
ctgccacctt |
tRNA gene sequence |
GGAGGGGTGGCAGAGTGGCCGAATGCACCGGTCTTGAAAACCGGCGACGGGAGACCGTCC |
Downstream region at tRNA end position |
aataaaaagc |
Secondary structure (Cloverleaf model) | >WENV170016372 Ser TGA t GCCA aataaaaagc G - C G - C A - T G - C G - C G - C G - C T A T C A C C C A T G A G | | | | | A G G A C G G T G G G C G | | | T T C A T G C C G A A CGACGGGAGACCGTCC C - G C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |