Sequence ID | >WENV170016377 |
Genome ID | AZIK01001907 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 10667 |
End posion on genome | 10591 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
gaacctgcaa |
tRNA gene sequence |
GCGCCTGTAGCTCAACCGGATAGAGCAACGGCCTTCTAAGCCGTCGGTTGCAGGTTCGAG |
Downstream region at tRNA end position |
ggcaggtaga |
Secondary structure (Cloverleaf model) | >WENV170016377 Arg TCT a GCCA ggcaggtaga G - C C - G G - C C - G C - G T - A G - C T G T C G T C C A C A A A | | | | | G C C T C G G C A G G C G | | | | T T G G A G C A T A A CGGTT A - T C - G G - C G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |