Sequence ID | >WENV170016389 |
Genome ID | AZIK01002319 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 880 |
End posion on genome | 796 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
gaagcgacac |
tRNA gene sequence |
GCGGGTGTGGCGAAATTGGTAGACGCACTAGATTTAGGTTCTAGCGCCGCAAGGCGTGGG |
Downstream region at tRNA end position |
aatcctttcc |
Secondary structure (Cloverleaf model) | >WENV170016389 Leu TAG c ACCA aatcctttcc G - C C - G G - C G - C G - C T - A G - C T G T C T C C C A T A A G | + | | | A T A G C G G G G G G C G | | | T T G A C G C T A G A CGCCGCAAGGCGT C - G T - A A - T G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |