Sequence ID | >WENV170016398 |
Genome ID | AZIK01002829 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 1088 |
End posion on genome | 1162 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
taccgaatat |
tRNA gene sequence |
GCTCATGTAGCTCAGGGGTAGAGCACACCCTTGGTAAGGGTGAGGTCGGCGGTTCAATTC |
Downstream region at tRNA end position |
tgtatttatg |
Secondary structure (Cloverleaf model) | >WENV170016398 Thr GGT t TCCA tgtatttatg G - C C - G T - A C - G A - T T - A G - C T T T C C G C C A G A A | | | | | A G C T C G G G C G G C G | | | | T T G G A G C T A A AGGTC C - G A - T C - G C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |