Sequence ID | >WENV170016401 |
Genome ID | AZIK01003104 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 298 |
End posion on genome | 389 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
accgcaatac |
tRNA gene sequence |
GGAGAGGTGGGTGAGTGGCTGAAACCACCAGTTTGCTAAACTGGCGTACTGAGCAATCGG |
Downstream region at tRNA end position |
aattttcggg |
Secondary structure (Cloverleaf model) | >WENV170016401 Ser GCT c GCAA aattttcggg G - C G - C A - T G - C A - T G - C G + T T A T C C C C C A T G A G | | | | | G G G T G G G G G G G C G | | | T T C A A C C T G A A CGTACTGAGCAATCGGTACC C - G C - G A - T G - C T - A T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |