Sequence ID | >WENV170016405 |
Genome ID | AZIK01003172 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 7124 |
End posion on genome | 7198 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
ccaaaagcgc |
tRNA gene sequence |
GGTCCATTCGTCTATCGGTTAGGACGCCAGGTTTTCAACCTGGAAAGAGGGGTTCGATTC |
Downstream region at tRNA end position |
cttatccccc |
Secondary structure (Cloverleaf model) | >WENV170016405 Glu TTC c GCCA cttatccccc G + T G - C T - A C - G C - G A - T T - A T T T T C C C C A C T A C | | | | | G G T C T G A G G G G C G + | | | T T T G G A C T A G AAAG C - G C - G A - T G - C G - C T A T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |