Sequence ID | >WENV170016408 |
Genome ID | AZIK01003478 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 913 |
End posion on genome | 823 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
nnnnnnnnnc |
tRNA gene sequence |
GGTGGGCTGGCAGAGTGGCTGAATGCAGCGGTCTTGAAAACCGCCGAAGGTTAGTAGCCT |
Downstream region at tRNA end position |
tttttcctct |
Secondary structure (Cloverleaf model) | >WENV170016408 Ser TGA c GCCA tttttcctct G - C G - C T - A G - C G - C G - C C - G T A T G T C C C A T G A G | + | | | G G G A C G C G G G G C G | | | T T C A T G C T G A A CGAAGGTTAGTAGCCTTCC G - C C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |