| Sequence ID | >WENV170016417 |
| Genome ID | AZIK01004085 |
| Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
| Species | |
| Start position on genome | 2726 |
| End posion on genome | 2802 |
| Amino Acid | Pro |
| Anticodon | CGG |
| Upstream region at tRNA start position |
gcgcagccat |
| tRNA gene sequence |
CGGAGTATAGCTCAGCTTGGTAGAGTACTACGTTCGGGACGTAGGGGTCGCAGGTTCGAA |
| Downstream region at tRNA end position |
atttaaaaag |
| Secondary structure (Cloverleaf model) | >WENV170016417 Pro CGG
t ACCA atttaaaaag
C - G
G - C
G - C
A - T
G - C
T - A
A - T T A
T C G T C C A
C G A A | | | | | G
T C T C G G C A G G C
T | | | + T T
G G A G T
G T A A GGGTC
C - G
T - A
A - T
C - G
G - C
T A
T G
C G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |