Sequence ID | >WENV170016420 |
Genome ID | AZIK01004246 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 4721 |
End posion on genome | 4647 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
agcacgataa |
tRNA gene sequence |
TGGGGTGTCGCCAAGTGGTAAGGCAACGGGTTTTGATCCCGTCATGCGCAGGTTCGAATC |
Downstream region at tRNA end position |
ccttcctccc |
Secondary structure (Cloverleaf model) | >WENV170016420 Gln TTG a GCCA ccttcctccc T - A G - C G - C G - C G - C T - A G - C T A T C G T C C A G A C | | | | | G T A C C G G C A G G C G | | | T T G A G G C T A A CATGC A - T C - G G - C G - C G - C T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |