Sequence ID | >WENV170016427 |
Genome ID | AZIK01004357 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 646 |
End posion on genome | 571 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
gccgcgcctt |
tRNA gene sequence |
CTCCCTGTAGTTCAACCGGATAGAACGGACCCCTCCTAAGGGTCAGATCGGGGTTCGAGT |
Downstream region at tRNA end position |
ataaatgttc |
Secondary structure (Cloverleaf model) | >WENV170016427 Arg CCT t GCCA ataaatgttc C - G T - A C - G C - G C - G T + G G - C T G T G T C C C A C A A A | + | | | G C C T T G C G G G G C G | | | | T T G G A A C A T A G AGAT G - C A - T C - G C - G C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |