Sequence ID | >WENV170016435 |
Genome ID | AZIK01004994 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 1959 |
End posion on genome | 2045 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
tcaagactgt |
tRNA gene sequence |
GCGGTCGTGGCGGAATTGGTAGACGCGCAGCGTTGAGGTCGCTGTGGGGTAACACCCGTG |
Downstream region at tRNA end position |
acactttccg |
Secondary structure (Cloverleaf model) | >WENV170016435 Leu GAG t ACCA acactttccg G - C C - G G - C G - C T - A C - G G - C T G T T C T T C A T A A G + | | | | G T G G C G G G A A G C G | | | T T G A C G C T A G G TGGGGTAACACCCGT C - G A - T G - C C - G G - C T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |