Sequence ID | >WENV170016436 |
Genome ID | AZIK01005072 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 653 |
End posion on genome | 729 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
gaagccgcag |
tRNA gene sequence |
GCACCCATAGCTCAGCTGGATAGAGCGCTGCCCTCCGAAGGCAGAGGCCGTAGGTTCGAA |
Downstream region at tRNA end position |
caatttcatc |
Secondary structure (Cloverleaf model) | >WENV170016436 Arg CCG g ACCA caatttcatc G - C C - G A - T C - G C - G C - G A - T T A T C A T C C A C G A A | | | | | G T C T C G G T A G G C G | | | | T T G G A G C A T A G AGGCC C - G T - A G - C C - G C - G C A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |