Sequence ID | >WENV170016447 |
Genome ID | AZIK01005871 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 5032 |
End posion on genome | 4956 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
cgggtagcgg |
tRNA gene sequence |
GCGGTTGTAGCTCAGTTGGTTAGAGTACCGGCCTGTCACGCCGGGGGTCGCGGGTTCGAG |
Downstream region at tRNA end position |
cgctaccaca |
Secondary structure (Cloverleaf model) | >WENV170016447 Asp GTC g GCCA cgctaccaca G - C C - G G - C G - C T - A T - A G - C C G T T G C C C A T G A A + | | | | G T C T C G G C G G G C G | | | + T T G G A G T T T A A GGGTC C - G C - G G - C G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |