Sequence ID | >WENV170016451 |
Genome ID | AZIK01006038 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 13355 |
End posion on genome | 13271 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
gccgcccatt |
tRNA gene sequence |
GCGCCAGTGGTGGAATTGGTAGACACGCCAGATTTAGGTTCTGGTGCCGAGAGGTGTGAA |
Downstream region at tRNA end position |
tcacaaagaa |
Secondary structure (Cloverleaf model) | >WENV170016451 Leu TAG t ACCA tcacaaagaa G - C C - G G - C C - G C - G A - T G - C T G T C T T C C A T A A G | | | | | A T G G T G G A A G G C G | | | T T G A C A C T A G G TGCCGAGAGGTGT C - G C - G A - T G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |