Sequence ID | >WENV170016452 |
Genome ID | AZIK01006152 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 4928 |
End posion on genome | 4839 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
accgcattcc |
tRNA gene sequence |
GGAGAGGTGGGTGAGTGGCTGAAACCAGCTCCCTGCTAAGGAGCCATACGGGAAACTGTA |
Downstream region at tRNA end position |
tattcaaaaa |
Secondary structure (Cloverleaf model) | >WENV170016452 Ser GCT c GCCA tattcaaaaa G - C G - C A - T G - C A - T G - C G - C T A T C G C C C A T G A G | | | | | G G G T G G G C G G G C G | | | T T C A A C C T G A A CATACGGGAAACTGTATC G - C C - G T - A C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |