Sequence ID | >WENV170016454 |
Genome ID | AZIK01006246 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 40651 |
End posion on genome | 40727 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
aacgagactt |
tRNA gene sequence |
GCACCGGTAGCTCAGCTGGATAGAGCAACTGGCTACGAACCAGTAGGTCGGGGGTTCGAC |
Downstream region at tRNA end position |
tacgattaaa |
Secondary structure (Cloverleaf model) | >WENV170016454 Arg ACG t ACCA tacgattaaa G - C C - G A - T C - G C - G G - C G - C T C T C T C C C A C G A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C A T A A AGGTC A - T C - G T - A G - C G - C C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |