Sequence ID | >WENV170016459 |
Genome ID | AZIK01006394 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 2795 |
End posion on genome | 2869 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
taaattgctc |
tRNA gene sequence |
GCGGGCATCGTATAGTGGCTATTACCTCAGCCTTCCAAGCTGATGACGCGGGTTCGATTC |
Downstream region at tRNA end position |
atttgcttga |
Secondary structure (Cloverleaf model) | >WENV170016459 Gly TCC c TCCA atttgcttga G - C C - G G - C G - C G - C C - G A - T T T T C G C C C A T G A C | | | | | G G T A T G G C G G G C G | | | T T C T T A C T A C TGAC T - A C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |