Sequence ID | >WENV170016471 |
Genome ID | AZIK01007596 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 7820 |
End posion on genome | 7744 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
cgatttctca |
tRNA gene sequence |
GGGCCTATAGCTCAGCTGGTTAGAGCAGTCGACTCATAATCGATTGGTCCCAGGTTCAAG |
Downstream region at tRNA end position |
tttctttatg |
Secondary structure (Cloverleaf model) | >WENV170016471 Met CAT a ACCA tttctttatg G - C G - C G - C C - G C - G T + G A - T T G T G G T C C A C G A A | | | | | A T C T C G C C A G G C G | | | | T T G G A G C T T A A TGGTC G + T T - A C - G G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |