Sequence ID | >WENV170016485 |
Genome ID | AZIK01009156 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 26585 |
End posion on genome | 26660 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
cgcctcttcc |
tRNA gene sequence |
GGGTCGTTAGCTCAGTTGGTAGAGCAGTTGGCTTTTAACCAATTGGTCGCTGGTTCGAAT |
Downstream region at tRNA end position |
cgattatccg |
Secondary structure (Cloverleaf model) | >WENV170016485 Lys TTT c ACCA cgattatccg G - C G - C G - C T - A C - G G - C T - A T A T C G A C C A T G A A | | | | | G T C T C G G C T G G C G | | | | T T G G A G C T A A TGGTC G + T T - A T - A G - C G - C C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |