Sequence ID | >WENV170016487 |
Genome ID | AZIK01009156 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 36901 |
End posion on genome | 36826 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
gttacgaagt |
tRNA gene sequence |
TCCCCGATAGCTCAGTCGGTAGAGCAGTAGACTGTTAATCTATTGGTCGTTGGTTCAAGT |
Downstream region at tRNA end position |
aacaacagca |
Secondary structure (Cloverleaf model) | >WENV170016487 Asn GTT t GCCA aacaacagca T - A C - G C - G C - G C - G G - C A - T T G T C A A C C A T G A A | | | | | A C C T C G G T T G G C G | | | | T T G G A G C T A A TGGTC G + T T - A A - T G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |