Sequence ID | >WENV170016489 |
Genome ID | AZIK01009599 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 623 |
End posion on genome | 698 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
ccgcgagagt |
tRNA gene sequence |
GGGCCGTTAGCTCAGTTGGTAGAGCAACTGACTTTTAATCAGTGGGTCGCAGGTTCGAAT |
Downstream region at tRNA end position |
ctcttttcaa |
Secondary structure (Cloverleaf model) | >WENV170016489 Lys TTT t ACCA ctcttttcaa G - C G + T G - C C - G C - G G - C T - A T A T C G T C C A T G A A | | | | | G T C T C G G C A G G C G | | | | T T G G A G C T A A GGGTC A - T C - G T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |