Sequence ID | >WENV170016491 |
Genome ID | AZIK01009764 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 2021 |
End posion on genome | 2094 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
cacacggcgc |
tRNA gene sequence |
GCGGGTATGGTGAAAAGGTATCACGGCAGCTTCCCAAGCTTTAGTTACGAGTTCGATTCT |
Downstream region at tRNA end position |
aacgtccccc |
Secondary structure (Cloverleaf model) | >WENV170016491 Gly CCC c TCCA aacgtccccc G - C C - G G - C G - C G - C T - A A - T T T T T G C T C A A A G | | | | | G A A G T G A C G A G C G | | | | T T G T C A C T A G AGTT G + T C T A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |