Sequence ID | >WENV170016493 |
Genome ID | AZIK01010228 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 2011 |
End posion on genome | 2087 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
acagagccac |
tRNA gene sequence |
GGTCCCGTAGCTCAACTGGATAGAGCACCTGACTTCTAATCAGGATGTTGGGGGTTCGAG |
Downstream region at tRNA end position |
ttttttcctt |
Secondary structure (Cloverleaf model) | >WENV170016493 Arg TCT c GCCA ttttttcctt G - C G + T T - A C - G C - G C - G G - C T G T C C T C C A C A A A | | + | | G T C T C G G G G G G C G | | | | T T G G A G C A T A A ATGTT C - G C - G T - A G - C A - T C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |