Sequence ID | >WENV170016494 |
Genome ID | AZIK01010451 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 1117 |
End posion on genome | 1041 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
aaaatcaact |
tRNA gene sequence |
GGGTCGGTAGCTCAGGTGGTTAGAGCGCACGCCTGATAAGCGTGAGGTCGGAGGTTCAAG |
Downstream region at tRNA end position |
tttcttatgg |
Secondary structure (Cloverleaf model) | >WENV170016494 Ile GAT t ACCA tttcttatgg G - C G - C G - C T - A C - G G - C G + T T G T C C T C C A G G A A | | | | | A T C T C G G G A G G C G | | | | T T G G A G C T T A G AGGTC C - G A - T C - G G - C C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |