Sequence ID | >WENV170016504 |
Genome ID | AZIK01010949 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 3855 |
End posion on genome | 3779 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gcggcacttc |
tRNA gene sequence |
GGCGGTGTAGCTCAGTTGGTTAGAGCAGCGGAATCATAATCCGCGTGTCCGGGGTTCGAG |
Downstream region at tRNA end position |
tccctcccaa |
Secondary structure (Cloverleaf model) | >WENV170016504 Met CAT c ACCA tccctcccaa G - C G - C C - G G - C G - C T - A G - C T G T G T C C C A T G A A | + | | | G T C T C G C G G G G C G | | | | T T G G A G C T T A A GTGTC G - C C - G G - C G - C A - T A A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |