Sequence ID | >WENV170016509 |
Genome ID | AZIK01011240 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 11208 |
End posion on genome | 11123 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
gcgggattgc |
tRNA gene sequence |
GCGGATGTGGTGGAATTGGTAGACACGCCATCTTGAGGGGGTGGTGAGCATAGCTTGTGC |
Downstream region at tRNA end position |
attattctaa |
Secondary structure (Cloverleaf model) | >WENV170016509 Leu GAG c ACCA attattctaa G - C C - G G - C G - C A - T T - A G - C T G T C G C T C A T A A G | | | | | G T G G T G G C G A G C G | | | T T G A C A C T A G G TGAGCATAGCTTGT C - G C - G A - T T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |